SubtiBank SubtiBank
mntD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mntD

manganese [SW|ABC transporter] (permease)
locus
BSU_30740
pI
6.31
mw
30.91 kDa
protein length
295 aa Sequence Blast
gene length
888 bp Sequence Blast
function
manganese uptake
product
manganese [SW|ABC transporter] (permease)
essential
no
synonyms
ytgD

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.6|Uptake of ions]
  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.2|Manganese]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,142,077 → 3,142,964

    The protein

    Protein family

  • ABC-3 integral membrane protein family (with [protein|1B7C4AD6CD0632051A0E8CA57034872D13FF67F9|MntC] and [protein|EE212953BC83BD6D69BF769D6E917F4F954BE1E2|ZnuB], according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|3C40A6E42A669E77ADBF5FFF334061C51F76A4F9|mntA]-[gene|7821C82C6C30079F713B84F1E4D654E07CE5072E|mntB]-[gene|1B7C4AD6CD0632051A0E8CA57034872D13FF67F9|mntC]-[gene|F7DA077FE47DBB409BE2B1D9F12A9D719C246166|mntD]
    description
    [Pubmed|10760146]

    regulatory mechanism

  • [protein|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR]: repression, [Pubmed|12950915], in [regulon|FF34DC303E8A7C9FAA205A6C2924961963B14EB1|MntR regulon]
  • regulation

  • repressed at high Mn(II) concentrations ([protein|search|MntR]) [Pubmed|12950915]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|mntA]' and '[protein|search|menC]' [PubMed|20525796]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A288 (ytgD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/288 NBRP B. subtilis, Japan]
  • BKE30740 (Δ[gene|F7DA077FE47DBB409BE2B1D9F12A9D719C246166|mntD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCAAAACTCATTTGCGAT, downstream forward: _UP4_GGCTGATGCAGCTCTTTCTT
  • BKK30740 (Δ[gene|F7DA077FE47DBB409BE2B1D9F12A9D719C246166|mntD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CTTCAAAACTCATTTGCGAT, downstream forward: _UP4_GGCTGATGCAGCTCTTTCTT
  • labs

  • [SW|John Helmann], Cornell University, USA [http://www.micro.cornell.edu/research/labs/helmann-lab/index.cfm Homepage]
  • References

  • 10760146,10092453,12950915,10760146,10760146