SubtiBank SubtiBank
resA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

resA

extracytoplasmic thioredoxin, cytochrome c biogenesis, reduces disulfide bonds in apo-cytochrome prior to the attachment of heme
locus
BSU_23150
pI
8.37
mw
20.76 kDa
protein length
179 aa Sequence Blast
gene length
540 bp Sequence Blast
function
cytochrome c biogenesis
product
extracytoplasmic thioredoxin
essential
no
synonyms
ypxA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW 2.1.2.4|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,420,804 → 2,421,343

    Phenotypes of a mutant

  • essential according to [http://www.ncbi.nlm.nih.gov/pubmed/12682299 Kobayashi et al.], but inactivation of ''resA'' was reported by [http://www.ncbi.nlm.nih.gov/pubmed/12637552 Erlendsson et al.] and by [http://www.ncbi.nlm.nih.gov/pubmed/26735940 Meeske et al. ]
  • inactivation of ''[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]'' reduces sporulation efficiency to 45.6% that of wild type cells; delayed entry into sporulation [Pubmed|26735940]
  • The protein

    Protein family

  • [SW|Thioredoxin family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0B299F9459023306FA91298A6162A09E4A87C3B2|StoA], [protein|50BBC8AB77B99B9FE5B8A8FE906D39DFEA4ED652|YneN]
  • [SW|Domains]

  • [SW|Thioredoxin domain] (aa 36-174) (according to UniProt)
  • Structure

  • [PDB|3C73]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]-[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|8631715]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE23150 (Δ[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCCACTGCCCCCTTC, downstream forward: _UP4_ATAAAACCCGGAGAGACTTC
  • BKK23150 (Δ[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23150 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCCACTGCCCCCTTC, downstream forward: _UP4_ATAAAACCCGGAGAGACTTC
  • References

  • 8631715,18422485,18456809,8631715,11222591,9988472,16825793,16971393,12637552,26735940