SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


39.12 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,245,147 → 2,246,148

    The protein

    Protein family

  • [SW|phage integrase family] (according to UniProt)
  • Biological materials


  • BKE21300 (Δ[gene|F7D30768A9A6962093C201A87E899C8F399E4858|yomM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATTCACCACCATTAG, downstream forward: _UP4_AAAAATCAAATATTTGTTTA
  • BKK21300 (Δ[gene|F7D30768A9A6962093C201A87E899C8F399E4858|yomM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATTCACCACCATTAG, downstream forward: _UP4_AAAAATCAAATATTTGTTTA
  • References

  • 27766092