SubtiBank SubtiBank
yomM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yomM

unknown
locus
BSU_21300
pI
8.26
mw
39.12 kDa
protein length
333 aa Sequence Blast
gene length
1002 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,245,147 → 2,246,148

    The protein

    Protein family

  • [SW|phage integrase family] (according to UniProt)
  • Biological materials

    Mutant

  • BKE21300 (Δ[gene|F7D30768A9A6962093C201A87E899C8F399E4858|yomM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATTCACCACCATTAG, downstream forward: _UP4_AAAAATCAAATATTTGTTTA
  • BKK21300 (Δ[gene|F7D30768A9A6962093C201A87E899C8F399E4858|yomM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATTCACCACCATTAG, downstream forward: _UP4_AAAAATCAAATATTTGTTTA
  • References

  • 27766092