SubtiBank SubtiBank
ydhU/1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ydhU/1

similar to Mn catalase, inactive pseudogene in strain 168
locus
BSU_05890
pI
0.00
mw
0.00 kDa
protein length
242 aa Sequence Blast
gene length
729 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
ydhU

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.9|Resistance against oxidative and electrophile stress/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    633,923 → 634,651

    Phenotypes of a mutant

  • thsi is a pseudogene in ''B. subtilis'' 168
  • The protein

    Protein family

  • manganese catalase family (according to Swiss-Prot)
  • Structure

  • [PDB|2CWL] (pseudokatalase from Thermus thermophilus, 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|BDDD52CE09533CFD6557B933F2AE1C9B94F9708B|ydhU/2]-[gene|F7C5C38298E1F1EF13A11332C92EA624D9381A3E|ydhU/1]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur]: repression, in [regulon|F899F1EE27E6D503BCC06BC52E3C7FD80B8EF725|Fur regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C196 (ydhU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2194 NBRP B. subtilis, Japan]
  • BKE05890 (Δ[gene|F7C5C38298E1F1EF13A11332C92EA624D9381A3E|ydhU/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE05890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGAAATTAGAGCTTTGGA, downstream forward: _UP4_TAATCCAGTGGGAAGGTGCT
  • BKK05890 (Δ[gene|F7C5C38298E1F1EF13A11332C92EA624D9381A3E|ydhU/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK05890 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TCTGAAATTAGAGCTTTGGA, downstream forward: _UP4_TAATCCAGTGGGAAGGTGCT
  • References

  • 12354229