SubtiBank SubtiBank
lysC [2019-05-07 15:38:50]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lysC [2019-05-07 15:38:50]

aspartokinase II (alpha and beta subunits)
43.65 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
biosynthesis of lysine
aspartokinase II (alpha and beta subunits)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    2,909,520 → 2,910,746

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-aspartate = ADP + 4-phospho-L-aspartate (according to Swiss-Prot)
  • Protein family

  • aspartokinase family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|DapG]
  • [SW|Domains]

  • two C-terminal [SW|ACT domain]s (aa 264 ... 337, and aa 343 ...408) (according to the Interpro database)
  • Structure

  • [PDB|2RE1] (from ''Neisseria meningitidis mc58'', 40% identity, 58% similarity)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983], also degraded upon ammonium or amino acid starvation [Pubmed|2168395]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [regulon|L-box|L-box]: transcription termination/antitermination, via a riboswitch, in [regulon|L-box|L-box]
  • regulation

  • expression activated by glucose (5.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials


  • BKE28470 (Δ[gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG
  • BKK28470 (Δ[gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG
  • References


  • 19946135,22079167
  • The [SW|L-box] [SW|riboswitch]

  • 14523230,14597663,19636616,21169337,22416067,23067368,31045204