SubtiBank SubtiBank
lysC
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

lysC

aspartokinase II (alpha and beta subunits)
locus
BSU_28470
pI
4.64
mw
43.65 kDa
protein length
408 aa Sequence Blast
gene length
1227 bp Sequence Blast
function
biosynthesis of lysine
product
aspartokinase II (alpha and beta subunits)
essential
no
ec
2.7.2.4
synonyms
ask,aecA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • Gene

    Coordinates
    2,909,520 → 2,910,746

    The protein

    Catalyzed reaction/ biological activity

  • ATP + L-aspartate --> 4-phospho-L-aspartate + ADP (according to UniProt)
  • Protein family

  • aspartokinase family (with [protein|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|DapG] and [protein|548E92526BC00999031D6EDE43FE061CE0448AFC|ThrD], according to UniProt)
  • Paralogous protein(s)

  • [protein|6D6718AC72C9D86EDE16B191EDAB3ABA488B689B|DapG]
  • [SW|Domains]

  • two C-terminal [SW|ACT domain]s (aa 264-337, and aa 343-408) (according to UniProt)
  • Effectors of protein activity

  • feedback inhibition by lysine [pubmed|15033471]
  • Structure

  • [PDB|2RE1] (from ''Neisseria meningitidis mc58'', 40% identity, 58% similarity)
  • [SW|Localization]

  • cytoplasm (according to UniProt)
  • Additional information

  • subject to Clp-dependent proteolysis upon glucose starvation [Pubmed|17981983], also degraded upon ammonium or amino acid starvation [Pubmed|2168395]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation

    Operons

    genes
    [gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]
    description
    [Pubmed|19636616]

    regulatory mechanism

  • [regulon|L-box|L-box]: transcription termination/antitermination, via a riboswitch, in [regulon|L-box|L-box]
  • regulation

  • expression activated by glucose (5.4 fold) [Pubmed|12850135]
  • view in new tab

    Biological materials

    Mutant

  • BKE28470 (Δ[gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG
  • BKK28470 (Δ[gene|F7B947938FB40E54D89A719E9610C5A4AA400674|lysC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28470 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTACCACCCTTTAC, downstream forward: _UP4_TAATGACAATCAAAAAGGCG
  • References

    Reviews

  • 19946135,22079167
  • Research papers

  • 15033471
  • The [SW|L-box] [SW|riboswitch]

  • 14523230,14597663,19636616,21169337,22416067,23067368,31045204,31267846,15033471