SubtiBank SubtiBank
dacF [2020-05-19 16:08:37]
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

dacF [2020-05-19 16:08:37]

penicillin-binding protein I, D-alanyl-D-alanine carboxypeptidase
43.13 kDa
protein length
389 aa Sequence Blast
gene length
1170 bp Sequence Blast
penicillin-binding protein I, D-alanyl-D-alanine carboxypeptidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,445,094 → 2,446,263

    The protein

    Catalyzed reaction/ biological activity

  • modifies degree of cross-linking of glycan strands in peptidoglycan
  • Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
  • Protein family

  • [SW|Peptidase S11 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7C3081BC8D416127A881627EB56C0628359111CF|DacA], [protein|76825D77907E8CE47B17ED56D7E2A348B1ADA5EC|DacB]
  • Structure

  • [PDB|4K91] (from Pseudomonas aeruginosa, 38% identity) [pubmed|23629710]
  • [SW|Localization]

  • secreted (via signal peptide) (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|15699190], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIAA]'': expressed early during sporulation
  • strongly repressed in the presence of salt (1.2 M NaCl) [pubmed|32419322]
  • view in new tab

    Biological materials


  • BKE23480 (Δ[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAAGCCCTCCATT, downstream forward: _UP4_TAATTATGCCGAATGACCAC
  • BKK23480 (Δ[gene|F7AD78F9AB98A150E8CDFC1D01A9F938FF9F8BD1|dacF]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTCAAAAGCCCTCCATT, downstream forward: _UP4_TAATTATGCCGAATGACCAC
  • References


  • 18266855
  • Original publications

  • 16497325,8936302,9864321,12107147,20817675,22123250,23629710