SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


pyruvate kinase, glycolytic enzyme
62.00 kDa
protein length
585 aa Sequence Blast
gene length
1758 bp Sequence Blast
catabolic enzyme in glycolysis
pyruvate kinase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Glycolysis]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.5|Phosphorylation on a Ser residue]
  • Gene

    2,984,788 → 2,986,545

    Phenotypes of a mutant

  • unable to grow with non-[protein|14ED1AF5038F43F3B151FCBABE6CFC5A2DA3AA6E|PtsI] carbohydrates (such as glucitol or glycerol) as single carbon source
  • suppression of ''[gene|41872E2EF00C79918DD077F2EF78F37E24FEB110|ftsZ]''(ts) mutation (reverted by addition of pyruvate) [Pubmed|24825009]
  • The protein

    Catalyzed reaction/ biological activity

  • ADP + phosphoenolpyruvate -→ ATP + pyruvate
  • The reaction is irreversible under physiological conditions
  • Protein family

  • PEP-utilizing enzyme family (according to Swiss-Prot) pyruvate kinase family, (C-terminal section: PEP-utilizing enzyme family)
  • Modification

  • phosphorylation on Ser36 [Pubmed|17218307], [Pubmed|16493705], phosphorylation on Ser536 or Ser546 [Pubmed|17726680], please note that the Ser is not on position 536 but rather at 538
  • [SW|Cofactors]

  • Mg2+, K+
  • Effectors of protein activity

  • Activated by PEP (Hill Coefficient 1,8) [Pubmed|4623707] [Pubmed|3711058]
  • Allosterically activated by AMP [Pubmed|3711058]
  • Activation by r5p and ADP [Pubmed|3711058]
  • Inhibition by ADP and f16bp in high concentrations; and ATP [Pubmed|3711058]
  • Structure

  • [PDB|2E28] (Geobacillus stearothermophilus) [pubmed|18511452]
  • [SW|Localization]

  • cytoplasm [Pubmed|16479537]
  • Additional information

  • The enzyme is a tetramer with four active sites [Pubmed|3711058]
  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation




  • twofold induced by glucose [Pubmed|11489127]
  • view in new tab

    Biological materials


  • GP589 (''pyk''::''cat''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP600 (''pyk''::''erm''), available in [SW|Jörg Stülke]'s lab, [Pubmed|23420519]
  • GP1745: BSB1 ''pyk::aphA3'', available in [SW|Jörg Stülke]' lab
  • BKE29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA
  • BKK29180 (Δ[gene|F76A03A71DADC32C7166E37B994EFED019FDF8A4|pyk]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGGTTCACTTCCTTCT, downstream forward: _UP4_TAATTACAGGTGAAAATGGA
  • Expression vectors

  • expression in ''E. coli'', N-terminal His-tag: pGP1100 (in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • expression in ''B. subtilis'', native protein: pGP1411 (in [SW|pBQ200]), available in [SW|Jörg Stülke]'s lab
  • expression in ''B. subtilis'', N-terminal Strep-tag: pGP1409 (in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • expression in ''B. subtilis'', C-terminal Strep-tag: pGP1410 (in [SW|pGP382]), available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • see ''[gene|A7E31A5EBCF343B3A841E5F6E9CDE3CA5D1622EB|pfkA]
  • two-hybrid system

  • ''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab, [pubmed|19193632]
  • labs

  • [SW|Jörg Stülke], University of Göttingen, Germany [ Homepage]
  • References

  • 17726680,16493705,11489127,17505547,10966427,17218307,3711058,4623707,21821766,22846916,23420519,24158146,24571712,15378759,24825009,28516784,18511452