SubtiBank SubtiBank
epsA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

epsA

extracellular polysaccharide synthesis, putative transmembrane modulator of [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB] activity, might activate [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB] autophosphorylation and substrate phosphorylation
locus
BSU_34370
pI
6.07
mw
25.75 kDa
protein length
234 aa Sequence Blast
gene length
705 bp Sequence Blast
function
biofilm formation
product
unknown
essential
no
synonyms
yveK

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.2|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW 4.1.2.1|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,529,151 → 3,529,855

    The protein

    Protein family

  • CapA family (with [protein|A696434A086A428D411CAF45B37CD8F82AC2503F|CapA] and [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA], according to UniProt)
  • CpsC/CapA family (with [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA], according to UniProt)
  • Paralogous protein(s)

  • [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]-[gene|5DB168A3D087AAEB003D7548A1A4356ABD07F712|epsC]-[gene|223E979276F07D69D0DDAEE906023A8AB4F37F8E|epsD]-[gene|5D717F9F54693FD0AA8BC49E10348637858F88B9|epsE]-[gene|DB47BA2A5E3BED51DD8630E7D321C099D74B46CF|epsF]-[gene|C4D81976AAE888C4FE89A2EE5CF9A763CAD645FF|epsG]-[gene|BD843389F95BFB905071547AB243413A617F12A8|epsH]-[gene|6EBD8F7065B6C1996067F3120DD9CFEA91D3A444|epsI]-[gene|5272E807B6B98541EA155AA9748320E25767F096|epsJ]-[gene|66076952E512D53FC1FC62455A86ACFA21AE120D|epsK]-[gene|D67665412B78B56752B460219445E4BEF52C3A1A|epsL]-[gene|40EA584CF77FFF7D7E4E74B414EC69ADE3A1585B|epsM]-[gene|0D24AB8D446CFFBC6DEAD3C10D1FA59551545FE8|epsN]-[gene|52A47B49B1FB955EE7E3C316B57A2B4134F78480|epsO]
    description
    [Pubmed|15661000]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR] by [protein|24D6A7DDCB25B99FBB670E9203F826596916B35C|SinI] or [protein|C17C296F3EB2E106C380E3B5D784F3FA63F4C9B7|SlrA] [PubMed|15661000,19788541]
  • expression is increased in [gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX] mutants [pubmed|32483306]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A073 (yveK::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/73 NBRP B. subtilis, Japan]
  • GP1517 (aphA3) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • GP1519 (''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'', aphA3) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • GP1567 ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]''::aphA3 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]''::spc [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • BKE34370 (Δ[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTCATAGCCTTCAG, downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
  • BKK34370 (Δ[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTCATAGCCTTCAG, downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
  • GFP fusion

  • GP1569 epsA-gfp (spc), available in [SW| Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1526 epsA-FLAG 3x spc (based on [SW|pGP1331]) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • Antibody

  • **
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [http://www.mcb.harvard.edu/Losick/ homepage]
  • References

    Reviews

  • 20735481
  • Original publications

  • 15661000,16430695,18047568,18647168,20351052,20817675,21856853,21815947,23646920,24493247,25085422,26283769,32483306