SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


extracellular polysaccharide synthesis, putative transmembrane modulator of [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB] activity, might activate [protein|9B668909E1380B287ACE58561DCF45FC29184D8B|EpsB] autophosphorylation and substrate phosphorylation
25.75 kDa
protein length
234 aa Sequence Blast
gene length
705 bp Sequence Blast
biofilm formation

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.2|Biofilm formation] → [category|SW|Matrix polysaccharide synthesis]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,529,151 → 3,529,855

    The protein

    Protein family

  • CapA family (with [protein|A696434A086A428D411CAF45B37CD8F82AC2503F|CapA] and [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA], according to UniProt)
  • CpsC/CapA family (with [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA], according to UniProt)
  • Paralogous protein(s)

  • [protein|8DCA50478136628DD9E5D01E89609A686EED9F57|TkmA]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|15661000], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]: activation, [Pubmed|23646920], in [regulon|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: anti-activation, (prevents binding of [protein|6AF1CB8998BE9C71DF4F1201A7F74FF7E75CB799|RemA]) [Pubmed|23646920], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [regulon|EAR riboswitch|EAR riboswitch]: processive antitermination, in [regulon|EAR riboswitch|EAR riboswitch]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|15661000]
  • additional information

  • induction by sequestration of [protein|search|SinR] by [protein|search|SinI] or [protein|search|SlrA] [PubMed|15661000,19788541]
  • view in new tab

    Biological materials


  • MGNA-A073 (yveK::erm), available at the [ NBRP B. subtilis, Japan]
  • GP1517 (aphA3) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • GP1519 (''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]-[gene|9B668909E1380B287ACE58561DCF45FC29184D8B|epsB]'', aphA3) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • GP1567 ''[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]''::aphA3 ''[gene|8DCA50478136628DD9E5D01E89609A686EED9F57|tkmA]''::spc [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • BKE34370 (Δ[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTCATAGCCTTCAG, downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
  • BKK34370 (Δ[gene|F6C4634BF871D9A01E27014FFED7527C54BF560D|epsA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATTCATAGCCTTCAG, downstream forward: _UP4_AAACATTTCGGGGAGTGAAG
  • GFP fusion

  • GP1569 epsA-gfp (spc), available in [SW| Jörg Stülke]'s lab
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1526 epsA-FLAG 3x spc (based on [SW|pGP1331]) [Pubmed|24493247], available in [SW| Jörg Stülke]'s lab
  • Antibody

  • **
  • labs

  • [SW|Richard Losick], Harvard Univ., Cambridge, USA [ homepage]
  • References


  • 20735481
  • Original publications

  • 15661000,16430695,18047568,18647168,20351052,20817675,21856853,21815947,23646920,24493247,25085422,26283769