SubtiBank SubtiBank
pftB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

pftB

pyruvate transporter
locus
BSU_28900
pI
9.81
mw
24.25 kDa
protein length
231 aa Sequence Blast
gene length
696 bp Sequence Blast
function
uptake of pyruvate
product
pyruvate transporter
essential
no
synonyms
ysbB

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.4|Transporter for organic acids]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.1|Utilization of organic acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,954,492 → 2,955,187

    Phenotypes of a mutant

  • strongly impaired growth with pyruvate as the single carbon source [Pubmed|28974613]
  • a ''[gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] [gene|E5E431AC5A7D03EEFF6D694CB25EED1570D739A2|yxaK]-[gene|5A43EDB738641C675D4136269F3638F9B609F238|yxaC] [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]'' triple mutant is severely delayed in pellicle formation [Pubmed|26060272]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of pyruvate [pubmed|28974613]
  • Protein family

  • CidB/LrgB family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane [pubmed|28974613]
  • Expression and Regulation

    Operons

    genes
    [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]
    description
    [Pubmed|21815947]

    regulatory mechanism

  • [protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT]: activation, [Pubmed|28974613,27422364], in [regulon|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, ([Pubmed|28974613,27422364], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre]: repression, in [regulon|65E2F7197D46F5C884CC96018EE4F3EEE94FFA18|Kre regulon]
  • regulation

  • induced by acetate [Pubmed|26060272]
  • induced by pyruvate ([protein|53BA24E91EEC797C95B8975C487F3C50CBBFA2E3|LytT]) [pubmed|28974613]
  • subject to carbon catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]) [pubmed|28974613]
  • additional information

  • the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon is strongly upregulated in a ''[SW|kre]'' mutant [Pubmed|26110430]
  • the [gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB] operon is strongly upregulated in a ''[SW|cshA]'' mutant [Pubmed|23175651]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A983 (ysbB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/983 NBRP B. subtilis, Japan]
  • GP1554 (''[gene|6F21B5E9EEF67E96808A1DEFA3A80DA2A0FF9462|pftA]-[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]''::''spc''), available in [SW|Jörg Stülke]'s lab
  • BKE28900 (Δ[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE28900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAGAACCTCCTGTT, downstream forward: _UP4_TAAGCCAAGGCTGAATGCCT
  • BKK28900 (Δ[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK28900 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAGAACCTCCTGTT, downstream forward: _UP4_TAAGCCAAGGCTGAATGCCT
  • GP2577 (Δ[gene|F6C3B267106E7510FABECF0B13ABF222901689A9|pftB]::tet comIQ12L) (in DK1042) available at [SW|Jörg Stülke]'s lab
  • References

    Reviews

  • 29208748,29354650
  • Original publications

  • 26060272,23175651,21815947,8969504,26110430,27422364,28974613