SubtiBank SubtiBank
yfmR
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfmR

similar to [SW|ABC transporter] (ATP-binding protein)
locus
BSU_07370
pI
5.00
mw
70.94 kDa
protein length
629 aa Sequence Blast
gene length
1890 bp Sequence Blast
function
unknown
product
[SW|ABC transporter] (ATP-binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.4|Unknown ABC transporters]
  • Gene

    Coordinates
    809,557 → 811,446

    The protein

    Catalyzed reaction/ biological activity

  • a paraloguous protein from ''E. coli'' (EttA) gates [SW|ribosome] entry into the translation elongation cycle [Pubmed|24389465,24389466]
  • Protein family

  • [SW|ABC transporter superfamily] (according to UniProt)
  • [SW|ABCF ATPase subfamily] [pubmed|30597160]
  • Paralogous protein(s)

  • [protein|1F56D3275386BB54A774BFA045C09E36D1268471|YdiF], [protein|2F79DB15D359A127C2D833CC0465E18E1725F539|YkpA], [protein|47B644F334A0BD501E77A198A61CE0F22BAB3E5E|YfmM]
  • [SW|Domains]

  • 2 [SW|ABC transporter domain]s (aa 4-255, aa 319-537) (according to UniProt)
  • Structure

  • [PDB|3J5S] (EttA from E. coli, 36% identity) [pubmed|24389465]
  • [PDB|4FIN] (EttA from E. coli, 36% identity) [pubmed|24389466]
  • Expression and Regulation

    Operons

    genes
    [gene|F69F15198ACF8A8347C450EEC09F000EECEDEC41|yfmR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C234 (yfmR::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2232 NBRP B. subtilis, Japan]
  • BKE07370 (Δ[gene|F69F15198ACF8A8347C450EEC09F000EECEDEC41|yfmR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCCTATCAATCCTC, downstream forward: _UP4_TAAAAAGCGTGGCCGCAGCA
  • BKK07370 (Δ[gene|F69F15198ACF8A8347C450EEC09F000EECEDEC41|yfmR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCCTATCAATCCTC, downstream forward: _UP4_TAAAAAGCGTGGCCGCAGCA
  • References

    Reviews

  • 30746819,24500425
  • Original publications

  • 10092453,24389466,24389465,27006457