SubtiBank SubtiBank
yxkH
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxkH

similar to polysaccharide deacetylase
locus
BSU_38800
pI
7.80
mw
31.26 kDa
protein length
279 aa Sequence Blast
gene length
840 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,983,187 → 3,984,026

    The protein

    Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • [SW|Domains]

  • [SW|NodB homology domain] (aa 119-279) (according to UniProt)
  • Structure

  • [PDB|1HD5] (from B. cereus, 30% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F66D9DFE457E2ADADD72DE7B99CD2FEE35C6462F|yxkH]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B742 (yxkH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1741 NBRP B. subtilis, Japan]
  • BKE38800 (Δ[gene|F66D9DFE457E2ADADD72DE7B99CD2FEE35C6462F|yxkH]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCTGCTTTCTG, downstream forward: _UP4_TCAATGAAATAAAAAAAGGC
  • BKK38800 (Δ[gene|F66D9DFE457E2ADADD72DE7B99CD2FEE35C6462F|yxkH]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCTGCTTTCTG, downstream forward: _UP4_TCAATGAAATAAAAAAAGGC
  • References

  • 10746760,26577401