SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to polysaccharide deacetylase
31.26 kDa
protein length
279 aa Sequence Blast
gene length
840 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,983,187 → 3,984,026

    The protein

    Protein family

  • [SW|polysaccharide deacetylase family] (according to UniProt)
  • [SW|Domains]

  • [SW|NodB homology domain] (aa 119-279) (according to UniProt)
  • Structure

  • [PDB|1HD5] (from B. cereus, 30% identity)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • MGNA-B742 (yxkH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE38800 (Δ[gene|F66D9DFE457E2ADADD72DE7B99CD2FEE35C6462F|yxkH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCTGCTTTCTG, downstream forward: _UP4_TCAATGAAATAAAAAAAGGC
  • BKK38800 (Δ[gene|F66D9DFE457E2ADADD72DE7B99CD2FEE35C6462F|yxkH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGTTCTCCTGCTTTCTG, downstream forward: _UP4_TCAATGAAATAAAAAAAGGC
  • References

  • 10746760,26577401