SubtiBank SubtiBank
yuzE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuzE

unknown
locus
BSU_31810
pI
5.72
mw
14.61 kDa
protein length
129 aa Sequence Blast
gene length
390 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,263,835 → 3,264,224

    Biological materials

    Mutant

  • MGNA-A645 (yuzE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/645 NBRP B. subtilis, Japan]
  • BKE31810 (Δ[gene|F652BA6D159B67DDA3ED383EC125065DAD70F714|yuzE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCAACACTCCTTTCA, downstream forward: _UP4_TAGGACGTCCTGTTGTACGC
  • BKK31810 (Δ[gene|F652BA6D159B67DDA3ED383EC125065DAD70F714|yuzE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCACCAACACTCCTTTCA, downstream forward: _UP4_TAGGACGTCCTGTTGTACGC