SubtiBank SubtiBank
ytvB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytvB

unknown
locus
BSU_30330
pI
9.53
mw
12.11 kDa
protein length
109 aa Sequence Blast
gene length
330 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,105,470 → 3,105,799

    The protein

    [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F63CE7A18775554DE1BAFEEB791D8199A5BD5D2B|ytvB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A137 (ytvB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/137 NBRP B. subtilis, Japan]
  • BKE30330 (Δ[gene|F63CE7A18775554DE1BAFEEB791D8199A5BD5D2B|ytvB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCACCTTCCTAAAGC, downstream forward: _UP4_TAATTGTCCTCAATCTCCGC
  • BKK30330 (Δ[gene|F63CE7A18775554DE1BAFEEB791D8199A5BD5D2B|ytvB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATCACCTTCCTAAAGC, downstream forward: _UP4_TAATTGTCCTCAATCTCCGC