SubtiBank SubtiBank
yunC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yunC

unknown
locus
BSU_32360
pI
6.93
mw
10.74 kDa
protein length
101 aa Sequence Blast
gene length
306 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    3,323,300 → 3,323,605

    Expression and Regulation

    Operons

    genes
    [gene|9F1EC331167AED680621A27ABC49DC411F01144F|yunG]-[gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]-[gene|26B4B215FAA2D91410F35852C418DA00261418CF|yunE]-[gene|A1C40F16DEB668FF3D7BF05E937FD4EEC3FE69C9|yunD]-[gene|F5E57D2FB348DAD9A65A1B1686742D1BA0E02C8F|yunC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|0F3DA3A773B53ECBAAEB571FD566726C9A75A7B4|yunF]-[gene|26B4B215FAA2D91410F35852C418DA00261418CF|yunE]-[gene|A1C40F16DEB668FF3D7BF05E937FD4EEC3FE69C9|yunD]-[gene|F5E57D2FB348DAD9A65A1B1686742D1BA0E02C8F|yunC]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F5E57D2FB348DAD9A65A1B1686742D1BA0E02C8F|yunC]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A979 (yunC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/979 NBRP B. subtilis, Japan]
  • BKE32360 (Δ[gene|F5E57D2FB348DAD9A65A1B1686742D1BA0E02C8F|yunC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCAACCACTCCCTTCA, downstream forward: _UP4_TAAAATAAATTGGCCCCGGC
  • BKK32360 (Δ[gene|F5E57D2FB348DAD9A65A1B1686742D1BA0E02C8F|yunC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCAACCACTCCCTTCA, downstream forward: _UP4_TAAAATAAATTGGCCCCGGC