SubtiBank SubtiBank
yutE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yutE

unknown
locus
BSU_32300
pI
4.58
mw
16.51 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,318,828 → 3,319,262

    The protein

    Protein family

  • UPF0331 family (single member, according to UniProt)
  • Structure

  • [PDB|1YLM]
  • Expression and Regulation

    Operons

    genes
    [gene|527956DFAF0BE1115E6FDC82B03527D0BA96D56F|yutD]-[gene|F5CA843AD704165EA1EAA490603001FD5C0F0119|yutE]-[gene|A44198B11130B97406FD360A287A945AF9200CE9|yutF]
    description
    [Pubmed|27907199]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A975 (yutE::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/975 NBRP B. subtilis, Japan]
  • BKE32300 (Δ[gene|F5CA843AD704165EA1EAA490603001FD5C0F0119|yutE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE32300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGCATCCCCTTTGT, downstream forward: _UP4_TAACAACTGGAAAGCCACAG
  • BKK32300 (Δ[gene|F5CA843AD704165EA1EAA490603001FD5C0F0119|yutE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK32300 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGCATCCCCTTTGT, downstream forward: _UP4_TAACAACTGGAAAGCCACAG
  • References

  • 27907199