SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


16.51 kDa
protein length
144 aa Sequence Blast
gene length
435 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    3,318,828 → 3,319,262

    The protein

    Protein family

  • UPF0331 family (single member, according to UniProt)
  • Structure

  • [PDB|1YLM]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [pubmed|22383849], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • view in new tab

    Biological materials


  • MGNA-A975 (yutE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE32300 (Δ[gene|F5CA843AD704165EA1EAA490603001FD5C0F0119|yutE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGCATCCCCTTTGT, downstream forward: _UP4_TAACAACTGGAAAGCCACAG
  • BKK32300 (Δ[gene|F5CA843AD704165EA1EAA490603001FD5C0F0119|yutE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACAGCATCCCCTTTGT, downstream forward: _UP4_TAACAACTGGAAAGCCACAG
  • References

  • 27907199