SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


two-component sensor kinase, regulation of the [SW|ABC transporter] [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL]-[protein|4423383A3F6DAFDFA210F4BEEF7D8CBEC674DCEA|YxdM] in response to the cationic antimicrobial peptide, LL-37
37.83 kDa
protein length
325 aa Sequence Blast
gene length
978 bp Sequence Blast
resistance against toxic peptides
two-component sensor kinase

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW|Protein kinases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Control of two-component response regulators] → [category|SW|Two-component sensor kinase]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    4,071,310 → 4,072,287

    Phenotypes of a mutant

  • defective in the the ability to support the growth of ''Synechococcus leopoliensis'' CCAP1405/1 on agar media [Pubmed|25875741]
  • The protein

    Catalyzed reaction/ biological activity

  • autophosphorylation, phosphorylation of [protein|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|YxdJ]
  • [SW|Domains]

  • two transmembrane segments, C-terminal histidine phosphotransferase domain
  • Modification

  • autophosphorylation on a His residue
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B804 (yxdK::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE39650 (Δ[gene|F5BB96607452AC38ECF66923DB8758C364FE2F46|yxdK]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCATGAGACCGGAGAAACA, downstream forward: _UP4_TAAGGCTGCGTTAAGAAAAC
  • BKK39650 (Δ[gene|F5BB96607452AC38ECF66923DB8758C364FE2F46|yxdK]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGCATGAGACCGGAGAAACA, downstream forward: _UP4_TAAGGCTGCGTTAAGAAAAC
  • References

  • 10094672,10746760,17600057,21283517,21078927,25875741