SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to transcriptional repressor ([SW|MarR family])
20.28 kDa
protein length
175 aa Sequence Blast
gene length
528 bp Sequence Blast

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Transcription factor/ other/ based on similarity]
  • Gene

    1,124,438 → 1,124,965

    The protein

    Protein family

  • [SW|MarR family]
  • Paralogous protein(s)

  • [protein|0D555F2AB7DC863E6FF388888308E980514DB719|PchR]
  • [SW|Domains]

  • [SW|HTH marR-type domain] (aa 10-157) (according to UniProt)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation


    view in new tab

    view in new tab

    Biological materials


  • MGNA-A722 (yhjH::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE10510 (Δ[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGGTTTTCCATCCTTT, downstream forward: _UP4_TAAAAAACACGCACTGCGGT
  • BKK10510 (Δ[gene|F5A59CE7727E0851652BB4C0144009154AB4978B|yhjH]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCGGGTTTTCCATCCTTT, downstream forward: _UP4_TAAAAAACACGCACTGCGGT