SubtiBank SubtiBank
yceG
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yceG

general stress protein, survival of ethanol stress
locus
BSU_02930
pI
5.96
mw
62.60 kDa
protein length
537 aa Sequence Blast
gene length
1614 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    314,883 → 316,496

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • Expression and Regulation

    Operons

    genes
    [gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|19047346], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG, downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
  • BKK02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG, downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
  • References

  • 15805528,11866510,18179421,23980836