SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, survival of ethanol stress
62.60 kDa
protein length
537 aa Sequence Blast
gene length
1614 bp Sequence Blast
survival of ethanol stress

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    314,883 → 316,496

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|19047346], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials


  • BKE02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG, downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
  • BKK02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG, downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
  • References

  • 15805528,11866510,18179421,23980836