SubtiBank SubtiBank
yceG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yceG

general stress protein, survival of ethanol stress
locus
BSU_02930
pI
5.96
mw
62.60 kDa
protein length
537 aa Sequence Blast
gene length
1614 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • Gene

    Coordinates
    314,883 → 316,496

    Phenotypes of a mutant

  • more sensitive to nisin [Pubmed|23980836]
  • Expression and Regulation

    Operons

    genes
    [gene|7E4742F30B4C43FBF9DAE0B02948022AE7912A33|yceC]-[gene|DF30A8B195B8D830E131B23C768F07BE61F51150|yceD]-[gene|863E26D497D29B820912A0C0F4A3AE4C6865EC2E|yceE]-[gene|F16A11027D8D320D3D64E44038E29921A946955B|yceF]-[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]-[gene|3A9EB32D5627FAB3F7646B7918E54C8D1ADD25DF|yceH]
    description
    [Pubmed|11866510]

    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|11866510], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|11544224,15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|19047346], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|11544224]
  • view in new tab

    Biological materials

    Mutant

  • BKE02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG, downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
  • BKK02930 (Δ[gene|F588108F12C5CA855A24159F28223EF67145D28F|yceG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCATATCCTCCTTTCCGG, downstream forward: _UP4_CAAAAATAAGGAGAGAAGAA
  • References

  • 15805528,11866510,18179421,23980836