SubtiBank SubtiBank
ynzF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ynzF

similar to delta-endotoxin
locus
BSU_17480
pI
4.74
mw
12.70 kDa
protein length
114 aa Sequence Blast
gene length
345 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,880,623 → 1,880,967

    The protein

    Structure

  • [PDB|5GHE] (from B. thuringiensis, 30% identity) [pubmed|27381865]
  • Biological materials

    Mutant

  • MGNA-B381 (ynzF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1380 NBRP B. subtilis, Japan]
  • BKE17480 (Δ[gene|F54B94C92AD96F736FAE7B1EC8B13D0B11126CE2|ynzF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTATTGTCCTCCTATG, downstream forward: _UP4_TAAAAGAAAAATAAGGGCCT
  • BKK17480 (Δ[gene|F54B94C92AD96F736FAE7B1EC8B13D0B11126CE2|ynzF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17480 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAGTATTGTCCTCCTATG, downstream forward: _UP4_TAAAAGAAAAATAAGGGCCT
  • References

    Research papers

  • 27381865