SubtiBank SubtiBank
rsbRB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rsbRB

probably part of the stressosome
locus
BSU13200
pI
4.79
mw
32.23 kDa
protein length
277 aa Sequence Blast
gene length
834 bp Sequence Blast
function
control of SigB activity
product
RsbR paralog
essential
no
synonyms
ispU,ykoB

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW 3.4.1.2|Control of sigma factors]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.6|Phosphorylation on a Thr residue]
  • Gene

    Coordinates
    1,387,206 → 1,388,039

    The protein

    Catalyzed reaction/ biological activity

  • negative regulator of [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA]-dependent light activation of the [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB] stress response [Pubmed|22287516]
  • Paralogous protein(s)

  • [protein|5EEEDE60CE9E5CDAEBAB0E03AABDF1DF62F1F002|RsbRC], [protein|621357D1FB6AC1B0499732EFE226F982B26CE34E|RsbR], [protein|6C5397BA5839E4DB25B370B39B6DA702147DA8B7|YtvA], [protein|979D7A45EAD97C99015029400A85795061BAA367|RsbRD]
  • Modification

  • phosphorylation on Thr-186 and probably also on Thr-220 by [protein|ADC52A22950736A0435AEEEC43F7407878786A81|RsbT] [Pubmed|21362065]
  • Expression and Regulation

    Operons

    genes
    [gene|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE13200 (Δ[gene|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACACTGCTCCTTTCCC, downstream forward: _UP4_TAAAAAAATCCGCTATCTGT
  • BKK13200 (Δ[gene|F53C527995909A1CFA72C7BF919DD10EE175C6D7|rsbRB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACACTGCTCCTTTCCC, downstream forward: _UP4_TAAAAAAATCCGCTATCTGT
  • References

  • 15312768,17726680,17726680,17218307,20019076,28271471,28727759