SubtiBank SubtiBank
queE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

queE

7-carboxy-7-deazaguanine (CDG) synthase, required for the synthesis of the modified ribonucleotide queuosine
locus
BSU_13740
pI
4.96
mw
26.97 kDa
protein length
243 aa Sequence Blast
gene length
732 bp Sequence Blast
function
tRNA modification
product
7-carboxy-7-deazaguanine (CDG) synthase
essential
no
synonyms
ykvL

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.8|tRNA modification and maturation]
  • Gene

    Coordinates
    1,440,542 → 1,441,273

    The protein

    Catalyzed reaction/ biological activity

  • radical-mediated ring rearrangement required to convert 6-carboxy-5,6,7,8-tetrahydropterin (CPH4) into 7-carboxy-7-deazaguanine (CDG) [pubmed|29303575]
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • S-adenosyl-L-methionine, Mg(2+) [Pubmed|23194065]
  • Structure

  • [PDB|5TGS] [pubmed|28045519]
  • Expression and Regulation

    Operons

    genes
    [gene|1925DFD1162E744E9175D07EC0FD72A75C79C6BF|queC]-[gene|BA6DD5C9AB9BFF9759E9ECC46CE3DF4EB7E67F52|queD]-[gene|F5189CAA5EF43FCF95E593E095F84B3BE486B347|queE]-[gene|5F96500CC46CC4DAECEBAD34EC50B10548E6D0F9|queF]
    description
    [Pubmed|14660578]

    regulatory mechanism

  • [regulon|preQ1 riboswitch|preQ1 riboswitch]: antitermination, in the absence of queuosine [Pubmed|19285444], in [regulon|preQ1 riboswitch|preQ1 riboswitch]
  • regulation

  • repressed in the presence of queuosine ([SW|preQ1 riboswitch]) [Pubmed|19285444]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A790 (ykvL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/790 NBRP B. subtilis, Japan]
  • BKE13740 (Δ[gene|F5189CAA5EF43FCF95E593E095F84B3BE486B347|queE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAAATTTCTAATACAGGAA, downstream forward: _UP4_GTATAATAGAAAGGAAGATG
  • BKK13740 (Δ[gene|F5189CAA5EF43FCF95E593E095F84B3BE486B347|queE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GAAAATTTCTAATACAGGAA, downstream forward: _UP4_GTATAATAGAAAGGAAGATG
  • References

  • 14660578,19285444,19354300,17384645,24362703,23194065,25933252,29303575,28045519