SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


involved in polyketide synthesis
46.62 kDa
protein length
420 aa Sequence Blast
gene length
1263 bp Sequence Blast
polyketide synthesis
hydroxymethylglutaryl CoA synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,789,943 → 1,791,205

    The protein

    Catalyzed reaction/ biological activity

  • 3-oxobutanoyl-[ACP] + acetyl-[ACP] + H2O --> (3S)-hydroxy-3-methylglutaryl-[ACP] + H+ + holo-[ACP] (according to UniProt)
  • Protein family

  • [SW|thiolase-like superfamily] (according to UniProt)
  • Structure

  • [PDB|4YXQ]
  • [PDB|4YXT] (E82A mutant)
  • [PDB|4YXV] (C114A mutant)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    view in new tab

    Biological materials


  • MGNA-A017 (pksG::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17150 (Δ[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTCTATTCCGGCTGAAA, downstream forward: _UP4_TCTGAGTTTCATCGGAAGTA
  • BKK17150 (Δ[gene|F4C96980640CB04D3017B8EBB02918006CBCF7BB|pksG]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CGCTTCTATTCCGGCTGAAA, downstream forward: _UP4_TCTGAGTTTCATCGGAAGTA
  • References

  • 23840410,22383849,24187085,27766092