SubtiBank SubtiBank
yonK
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yonK

unknown
locus
BSU_21060
pI
4.53
mw
7.14 kDa
protein length
gene length
192 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,227,297 → 2,227,488

    The protein

    Structure

  • [PDB|2H4O]
  • Expression and Regulation

    Operons

    genes
    [gene|F4C6C530D2F0067F3AF71D1C592939C400D05112|yonK]-[gene|2655683C0EE274CBC41D119FC23FFFC80F79FF57|yonJ]-[gene|0BFE2B9F155C828970E028438182F83FDEA08D7D|yonH]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE21060 (Δ[gene|F4C6C530D2F0067F3AF71D1C592939C400D05112|yonK]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE21060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAATTCCTCCAATAA, downstream forward: _UP4_GTTGAGTAAGGAGATGACTG
  • BKK21060 (Δ[gene|F4C6C530D2F0067F3AF71D1C592939C400D05112|yonK]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK21060 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAATTCCTCCAATAA, downstream forward: _UP4_GTTGAGTAAGGAGATGACTG