SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


general stress protein, survival of ethanol stress
12.00 kDa
protein length
115 aa Sequence Blast
gene length
348 bp Sequence Blast
survival of ethanol stress

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    827,455 → 827,802

    Expression and Regulation


    view in new tab

    (according to [ DBTBS]) null

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials


  • MGNA-C332 (yflT::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07550 (Δ[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGATATTCCTCCTTC, downstream forward: _UP4_TAAAGCAAGGAAAAAACCAA
  • BKK07550 (Δ[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGATATTCCTCCTTC, downstream forward: _UP4_TAAAGCAAGGAAAAAACCAA
  • References

  • 12107147,15805528