SubtiBank SubtiBank
yflT
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yflT

general stress protein, survival of ethanol stress
locus
BSU_07550
pI
4.81
mw
12.00 kDa
protein length
115 aa Sequence Blast
gene length
348 bp Sequence Blast
function
survival of ethanol stress
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • Gene

    Coordinates
    827,455 → 827,802

    Expression and Regulation

    Operons

    genes
    [gene|9D4B8B6EDF69794135C5937B424B923B32C60B56|yfmA]-[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yflT.html DBTBS]) null

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C332 (yflT::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2330 NBRP B. subtilis, Japan]
  • BKE07550 (Δ[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGATATTCCTCCTTC, downstream forward: _UP4_TAAAGCAAGGAAAAAACCAA
  • BKK07550 (Δ[gene|F4C3F9C671B523AF11E8412A196162FEBE6BE923|yflT]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07550 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCGATATTCCTCCTTC, downstream forward: _UP4_TAAAGCAAGGAAAAAACCAA
  • References

  • 12107147,15805528