SubtiBank SubtiBank
yxjJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxjJ

general stress protein, survival of ethanol, paraquat and salt stresses
locus
BSU_38930
pI
8.44
mw
10.42 kDa
protein length
gene length
264 bp Sequence Blast
function
survival of stress conditions
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.1|General stress proteins (controlled by SigB)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.8|Resistance against oxidative and electrophile stress]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,996,829 → 3,997,092

    The protein

    [SW|Localization]

  • membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]-[gene|660443DFA2D175758677E4F88A2CEEC3BB5A2399|yxjI]
    description
    [Pubmed|10746760]

    sigma factors

  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: repression, in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • induced by stress ([protein|search|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B800 (yxjJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1799 NBRP B. subtilis, Japan]
  • BKE38930 (Δ[gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAACTGTCCCTCTAAA, downstream forward: _UP4_TAATTCTATATTTCAAACGA
  • BKK38930 (Δ[gene|F4C0A4050414B2FC9D6E571419D9537707DA4C05|yxjJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38930 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAGAAACTGTCCCTCTAAA, downstream forward: _UP4_TAATTCTATATTTCAAACGA
  • References

  • 16672620,20525796,15805528,22582280