SubtiBank SubtiBank
yxiC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxiC

unknown
locus
BSU_39310
pI
7.26
mw
9.66 kDa
protein length
gene length
270 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,038,513 → 4,038,782

    Expression and Regulation

    Operons

    genes
    [gene|75B0239578C92D4F3B298CBB077635BF5567C590|yxiB]-[gene|F44437883F39E5240D36340A7DD07803C5090ABB|yxiC]-[gene|BD8C0563C7123B6DEC1EEB602BDF2C9D92D34991|yxiD]-[gene|0DAFBDDC5E41592D06F97D404E75AF14B6783729|yxxD]-[gene|2710D9FD5FA50E09B4E482C13140F69B13C71861|yxxE]
    description
    [Pubmed|22383849,7883710,10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B785 (yxiC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1784 NBRP B. subtilis, Japan]
  • BKE39310 (Δ[gene|F44437883F39E5240D36340A7DD07803C5090ABB|yxiC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTGTGCCATTTGTGCTC, downstream forward: _UP4_AAATAAAGCGCGGGAGGACA
  • BKK39310 (Δ[gene|F44437883F39E5240D36340A7DD07803C5090ABB|yxiC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCTGTGCCATTTGTGCTC, downstream forward: _UP4_AAATAAAGCGCGGGAGGACA