SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


involved in polyketide synthesis
27.80 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
polyketide synthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of antibacterial compounds]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.15|Biosynthesis of antibacterial compounds]
  • Gene

    1,792,012 → 1,792,761

    The protein

    Protein family

  • enoyl-CoA hydratase/isomerase family (according to Swiss-Prot)
  • Structure

  • [PDB|4Q1G] and [PDB|4Q1H] (wildtype with different buffer components co-crystallized)
  • [PDB|4Q1I] (A80K)
  • [PDB|4Q1J] (A230H)
  • [PDB|4Q1K] (A232K)
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|24187085], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: activation, [Pubmed|24187085], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed during the transition from growth to stationary phase ([protein|search|AbrB], [protein|search|CodY]) [Pubmed|24187085]
  • additional information

  • this is a very large operon comprising about 75 kb
  • view in new tab

    view in new tab

    Biological materials


  • BKE17170 (Δ[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCCTCCTAACGGT, downstream forward: _UP4_TAACTGAAAATATATATAAA
  • BKK17170 (Δ[gene|F437A90A97CF8ED4BA1E5CCA8A33D9E93612902B|pksI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATGTCCTCCTAACGGT, downstream forward: _UP4_TAACTGAAAATATATATAAA
  • References

  • 22383849,24187085,27766092