SubtiBank SubtiBank
yodU
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

yodU

5' part of the split gene [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP] (together with [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP]), legionaminic acid synthesis, in B. subtilis 168 the gene is disrupted by the [category|SW 5.1.2|SP-beta prophage]
locus
BSU_19810
pI
9.82
mw
15.00 kDa
protein length
139 aa Sequence Blast
gene length
420 bp Sequence Blast
function
legionaminic acid synthesis
product
UDP-NAcGlcA inverting 4,6-dehydratase (N-terminal part)
essential
no
synonyms
ypqP,spsM

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW 2.6.6.8|Biosynthesis of legionaminic acid (for spore crust))]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,151,626 → 2,152,045

    Phenotypes of a mutant

  • the [gene|240CD6EA3793821F5109252BDEF69C0120E454EF|ypqP] mutant of PY79 has a less hydrophobic spore surface [pubmed|32817102]
  • The protein

    Catalyzed reaction/ biological activity

  • SpsM catalyzes the C-4/C-6 dehydration of the UDP-GlcNAc to produce UDP-4-keto-6-deoxy-GlcNAc, this is the first reaction of the legionaminic acid biosynthesis pathway [pubmed|32817102]
  • required for spore crust assembly, legionaminic acid synthesis [pubmed|32817102]
  • Paralogous protein(s)

  • [protein|5DB168A3D087AAEB003D7548A1A4356ABD07F712|EpsC]:
  • [SW|Domains]

  • SpsM: Polysacc_synt_2 domain (Pfam accession number, PF02719) in the 18–296-aa region [Pubmed|25299644]
  • Structure

  • [PDB|2GN4] (from Helicobacter pylori, 46% identity) [pubmed|16651261]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]
    description
    [Pubmed|22383849]

    sigma factors

  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|25299644,15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25299644,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed late during [SW|sporulation] in the mother cell ([protein|search|SigK], [protein|search|GerE]) [Pubmed|25299644,15383836]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A060 (yodU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/60 NBRP B. subtilis, Japan]
  • BKE19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • BKK19810 (Δ[gene|F42B27D5D7F3F39828940E377ABCC0730B25EA88|yodU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19810 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGCTTATCCTCCAACTC, downstream forward: _UP4_GTATATTAAGATACTTACTA
  • References

  • 25299644,15383836,25326298,28535266,16651261,32817102