SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


nucleoid-associated protein
10.27 kDa
protein length
gene length
276 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,733,410 → 1,733,685

    The protein


  • [PDB|1G2R] (from ''Streptococcus pneumoniae'', 47% identity) [Pubmed|11679764]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8491709], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528,26577401], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA]: attenuation, [protein|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA] stimulates termination [Reference|], in [regulon|8887ADC77C43F21CD375BDAA4D38E940786DAD4F|NusA regulon]
  • regulation

  • autoregulation [SW|NusA] [ reference]
  • induced by glucose [pubmed|30355672]
  • view in new tab

    Biological materials


  • MGNA-B078 (ylxR::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16610 (Δ[gene|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAAAGTCACCTCTTAT, downstream forward: _UP4_CTGGCGGAAAAGGTGAAAAA
  • BKK16610 (Δ[gene|F4097349A563503468A2A14F062AEAC532C7917A|ylxR]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCTAAAGTCACCTCTTAT, downstream forward: _UP4_CTGGCGGAAAAGGTGAAAAA
  • References

  • 11948165,8491709,11679764,30355672,31118925