SubtiBank SubtiBank
The papers of the month are back! Check them out! Link here


ribosomal protein
12.32 kDa
protein length
113 aa Sequence Blast
gene length
339 bp Sequence Blast
ribosomal protein L22 (BL17)

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    138,497 → 138,838

    Phenotypes of a mutant

  • essential [Pubmed|28189581]
  • The protein

    Protein family

  • [SW|ribosomal protein] L22P family (according to Swiss-Prot)
  • Structure

  • [PDB|3J9W] (the [SW|ribosome]) [Pubmed|25903689]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9371452] (two promoters, about 140bp and 200bp upstream of the start codon), in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [regulon|stringent response|stringent response]: negative regulation, in [regulon|stringent response|stringent response]
  • regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • likely autorepression of operon expression upon binding of excess of one ribosomal protein to the untranslated region of the mRNA [Pubmed|17616982]
  • additional information

  • term-seq has identified a potential novel regulatory RNA element (protein-dependent leader) including an intrinsic transcription terminator upstream of ''rpsJ'' [Pubmed|27120414]
  • view in new tab

    Biological materials


  • BKE01210 (Δ[gene|F3DE42C41EF57DC5DFFF0D28129F2CE5DB781D99|rplV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTAAAAGCCTCCTCTCT, downstream forward: _UP4_TCAGAAAAGAAGGAGGGATA
  • References

  • 19653700,9371452,11948165,8635744,23002217,18288106,25903689,25903689,28189581