SubtiBank SubtiBank
yxdJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxdJ

two-component response regulator ([SW|OmpR family]), regulation of the ABC transporter [protein|8B4267532B9788AEB5EF39E2695C1FDA494C7055|YxdL]-[protein|4423383A3F6DAFDFA210F4BEEF7D8CBEC674DCEA|YxdM] in response to the cationic antimicrobial peptide, LL-37
locus
BSU_39660
pI
4.94
mw
26.45 kDa
protein length
229 aa Sequence Blast
gene length
690 bp Sequence Blast
function
resistance against toxic peptides
product
two-component response regulator ([SW|OmpR family])
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.13|Resistance against toxins/ antibiotics]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    4,072,284 → 4,072,973

    The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 3-116) (according to UniProt)
  • Modification

  • phosphorylated by [protein|F5BB96607452AC38ECF66923DB8758C364FE2F46|YxdK] on an Asp residue
  • Structure

  • [PDB|5DCL] (NisR from Streptococcus agalactiae, 41% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]-[gene|F5BB96607452AC38ECF66923DB8758C364FE2F46|yxdK]
    description
    [Pubmed|10746760]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B702 (yxdJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1701 NBRP B. subtilis, Japan]
  • BKE39660 (Δ[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTGAACCACTCCCGTT, downstream forward: _UP4_GGCTACCAGCTGAGGGCGCA
  • BKK39660 (Δ[gene|F3C5505E311E6DDABAFA87899F28CF6596CDBA63|yxdJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39660 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACTGAACCACTCCCGTT, downstream forward: _UP4_GGCTACCAGCTGAGGGCGCA
  • References

  • 10094672,17600057,10746760,15289557,21078927,21283517,23504016,26930060