SubtiBank SubtiBank
ydzV

ydzV

unknown, fragment of putative phage terminase
locus
BSU_06049
pI
0.00
mw
0.00 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast
function
unknown
product
unknown
essential
-
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    654,333 → 654,692

    Biological materials

    Mutant

  • BKE06049 (Δ[gene|F3BE39EE646950D6269D63B66F28DFE36DE14D72|ydzV]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06049 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTCCTACACGCCATG, downstream forward: _UP4_TAGAGCAAAGAAATAATCAA
  • BKK06049 (Δ[gene|F3BE39EE646950D6269D63B66F28DFE36DE14D72|ydzV]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06049 BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTCCTACACGCCATG, downstream forward: _UP4_TAGAGCAAAGAAATAATCAA