SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


unknown, fragment of putative phage terminase
0.00 kDa
protein length
119 aa Sequence Blast
gene length
360 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    654,333 → 654,692

    Biological materials


  • BKE06049 (Δ[gene|F3BE39EE646950D6269D63B66F28DFE36DE14D72|ydzV]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTCCTACACGCCATG, downstream forward: _UP4_TAGAGCAAAGAAATAATCAA
  • BKK06049 (Δ[gene|F3BE39EE646950D6269D63B66F28DFE36DE14D72|ydzV]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATCACTCCTACACGCCATG, downstream forward: _UP4_TAGAGCAAAGAAATAATCAA