SubtiBank SubtiBank
ykoY
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ykoY

manganese resistance protein
locus
BSU_13440
pI
9.73
mw
35.38 kDa
protein length
324 aa Sequence Blast
gene length
975 bp Sequence Blast
function
resistance to Mn2+ intoxication
product
manganese resistance protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.3|Homeostasis] → [category|SW 1.3.2|Trace metal homeostasis (Cu, Zn, Ni, Mn, Mo)] → [category|SW 1.3.2.2|Manganese]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,410,654 → 1,411,628

    The protein

    Protein family

  • [SW|TerC family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|96CE303E9F757FBEBDEA5ADC8481697E2CD1361A|ykoX]-[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]
    description
    [Pubmed|25794618]

    regulatory mechanism

  • [regulon|yybP-ykoY motif|yybP-ykoY motif]: antitermination, via riboswitch in the presence of the ligand Mn2+ [Pubmed|25794618], in [regulon|yybP-ykoY motif|yybP-ykoY motif]
  • regulation

  • induced in the presence of Mn2+ ([[yybP-ykoY motif]]) [Pubmed|25794618]
  • the [SW|RNA switch] RNA is degraded by [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] [pubmed|29794222]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A780 (ykoY::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/780 NBRP B. subtilis, Japan]
  • BKE13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE13440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC, downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
  • BKK13440 (Δ[gene|F39BC9CA68DD8E80D3ED021272A6F54EA9C57C7B|ykoY]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK13440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCGGACGCTACTCCCC, downstream forward: _UP4_TAATCTGAAAGACTCTGCTT
  • References

  • 15096624,25794618,25794619,29794222,31685536