SubtiBank SubtiBank
psd [2020-10-31 17:13:35]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

psd [2020-10-31 17:13:35]

phosphatidylserine decarboxylase
29.54 kDa
protein length
263 aa Sequence Blast
gene length
792 bp Sequence Blast
biosynthesis of phospholipids
phosphatidylserine decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    248,749 → 249,540

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-L-serine + H+ --> 1,2-diacyl-sn-glycero-3-phosphoethanolamine + CO2 (according to UniProt)
  • Protein family

  • phosphatidylserine decarboxylase family (single member, according to UniProt)
  • Structure

  • [PDB|6L06] (from E. coli, corresponds to aa 26 ... 208, 29.1% identity)
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14762009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • view in new tab

    Biological materials


  • BKE02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • BKK02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • References

  • 14762009,18820022,9422599,15743965