SubtiBank SubtiBank
psd [2019-06-18 09:14:33]
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

psd [2019-06-18 09:14:33]

phosphatidylserine decarboxylase
locus
BSU02290
pI
7.27
mw
29.54 kDa
protein length
263 aa Sequence Blast
gene length
792 bp Sequence Blast
function
biosynthesis of phospholipids
product
phosphatidylserine decarboxylase
essential
no
ec
4.1.1.65
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    248,749 → 249,540

    The protein

    Catalyzed reaction/ biological activity

  • Phosphatidyl-L-serine = phosphatidylethanolamine + CO2 (according to Swiss-Prot)
  • Protein family

  • Type 1 subfamily (according to Swiss-Prot)
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Expression and Regulation

    Operons

    genes
    [gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
    description
    [Pubmed|22383849,14762009]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14762009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • BKK02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • References

  • 14762009,18820022,9422599,15743965