SubtiBank SubtiBank
psd
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

psd

phosphatidylserine decarboxylase
locus
BSU_02290
pI
7.27
mw
29.54 kDa
protein length
263 aa Sequence Blast
gene length
792 bp Sequence Blast
function
biosynthesis of phospholipids
product
phosphatidylserine decarboxylase
essential
no
ec
4.1.1.65
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    248,749 → 249,540

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-L-serine + H+ --> 1,2-diacyl-sn-glycero-3-phosphoethanolamine + CO2 (according to UniProt)
  • Protein family

  • phosphatidylserine decarboxylase family (single member, according to UniProt)
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Expression and Regulation

    Operons

    genes
    [gene|27FB777AEBCC794A5A768C7FE7D8374BCEA75913|ybfK]-[gene|DE49797486CEC172F912D26A6BF2223190BF5DAD|pssA]-[gene|B2C089DCE51CA0CB11947FCD6F4EFAFF66269829|ybfM]-[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]
    description
    [Pubmed|22383849,14762009]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14762009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE02290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • BKK02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK02290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • References

  • 14762009,18820022,9422599,15743965