SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


phosphatidylserine decarboxylase
29.54 kDa
protein length
263 aa Sequence Blast
gene length
792 bp Sequence Blast
biosynthesis of phospholipids
phosphatidylserine decarboxylase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of phospholipids]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    248,749 → 249,540

    The protein

    Catalyzed reaction/ biological activity

  • 1,2-diacyl-sn-glycero-3-phospho-L-serine + H+ --> 1,2-diacyl-sn-glycero-3-phosphoethanolamine + CO2 (according to UniProt)
  • Protein family

  • phosphatidylserine decarboxylase family (single member, according to UniProt)
  • Structure

  • [PDB|6L06] (from E. coli, corresponds to aa 26 ... 208, 29.1% identity) [pubmed|32402247]
  • [SW|Localization]

  • cell membrane at the septum [Pubmed|15743965]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14762009], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • view in new tab

    Biological materials


  • BKE02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • BKK02290 (Δ[gene|F34915697F3EF05E6A683055F46346C73F25CAFC|psd]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_TATTAAACATGAATAATCCC, downstream forward: _UP4_TAAAAAGAGGAGCTTGCATA
  • References

  • 14762009,18820022,9422599,15743965,32402247