SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|sporulation ]protein
20.31 kDa
protein length
179 aa Sequence Blast
gene length
540 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,916,006 → 1,916,545

    Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-B386 (yndM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE17830 (Δ[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTACTATTTTAAACAG, downstream forward: _UP4_TAGGAGGCTGTCTTATCGCC
  • BKK17830 (Δ[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTACTATTTTAAACAG, downstream forward: _UP4_TAGGAGGCTGTCTTATCGCC