SubtiBank SubtiBank
yndM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yndM

[SW|sporulation ]protein
locus
BSU_17830
pI
5.64
mw
20.31 kDa
protein length
179 aa Sequence Blast
gene length
540 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,916,006 → 1,916,545

    Expression and Regulation

    Operons

    genes
    [gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B386 (yndM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1385 NBRP B. subtilis, Japan]
  • BKE17830 (Δ[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE17830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTACTATTTTAAACAG, downstream forward: _UP4_TAGGAGGCTGTCTTATCGCC
  • BKK17830 (Δ[gene|F32542256C5A768A0FE12028669D538A53B033F4|yndM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK17830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTACTATTTTAAACAG, downstream forward: _UP4_TAGGAGGCTGTCTTATCGCC