SubtiBank SubtiBank
yqaS

yqaS

similar to phage-related terminase
locus
BSU_26200
pI
9.22
mw
27.52 kDa
protein length
239 aa Sequence Blast
gene length
720 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,689,594 → 2,690,313

    Expression and Regulation

    Operons

    genes
    [gene|F31F8857CE1BB7F56FAD0B87528F22EDE5BC2B92|yqaS]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|26577401], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • BKE26200 (Δ[gene|F31F8857CE1BB7F56FAD0B87528F22EDE5BC2B92|yqaS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTACATTCACTGCCGCC, downstream forward: _UP4_ACCATTGTAAACAAAGGTGA
  • BKK26200 (Δ[gene|F31F8857CE1BB7F56FAD0B87528F22EDE5BC2B92|yqaS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26200 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTACATTCACTGCCGCC, downstream forward: _UP4_ACCATTGTAAACAAAGGTGA
  • References

  • 26577401