SubtiBank SubtiBank
ylaM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylaM

glutaminase, high affinity for glutamine
locus
BSU_14830
pI
5.68
mw
33.86 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
function
glutamine degradation
product
glutaminase
essential
no
ec
3.5.1.2
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.1|Utilization of glutamine/ glutamate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    1,551,385 → 1,552,314

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • Protein family

  • glutaminase family (with [protein|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|YlaM], according to UniProt)
  • Paralogous protein(s)

  • [protein|1A415DC85354373EA4866733C3AE43F510BD3C56|GlsA]
  • Structure

  • [PDB|3BRM] (the structure of [protein|1A415DC85354373EA4866733C3AE43F510BD3C56|GlsA]) [Pubmed|18459799]
  • Expression and Regulation

    Operons

    genes
    [gene|5913ABC121A03644897BD365D7E507661CD3AF39|ylaK]-[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]
    description
    [pubmed|22383849]
    regulation
    expressed during [SW|sporulation] [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A542 (ylaM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/542 NBRP B. subtilis, Japan]
  • BKE14830 (Δ[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE14830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACACCCTCGTTCC, downstream forward: _UP4_TAATTTATGTCATATGCTTA
  • BKK14830 (Δ[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK14830 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACACCCTCGTTCC, downstream forward: _UP4_TAATTTATGTCATATGCTTA
  • References

  • 18459799