SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


glutaminase, high affinity for glutamine
33.86 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
glutamine degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of glutamine/ glutamate]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    1,551,385 → 1,552,314

    The protein

    Catalyzed reaction/ biological activity

  • H2O + L-glutamine --> L-glutamate + NH4+ (according to UniProt)
  • Protein family

  • glutaminase family (with [protein|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|YlaM], according to UniProt)
  • Paralogous protein(s)

  • [protein|1A415DC85354373EA4866733C3AE43F510BD3C56|GlsA]
  • Structure

  • [PDB|3BRM] (the structure of [protein|1A415DC85354373EA4866733C3AE43F510BD3C56|GlsA]) [Pubmed|18459799]
  • Expression and Regulation


    expressed during [SW|sporulation] [pubmed|22383849]
    view in new tab

    Biological materials


  • MGNA-A542 (ylaM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE14830 (Δ[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACACCCTCGTTCC, downstream forward: _UP4_TAATTTATGTCATATGCTTA
  • BKK14830 (Δ[gene|F31DD310F0D80ECC7C6D1E5DDB8EAF32565A3D51|ylaM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCAAACACCCTCGTTCC, downstream forward: _UP4_TAATTTATGTCATATGCTTA
  • References

  • 18459799