SubtiBank SubtiBank
ydiM
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydiM

unknown
locus
BSU_06040
pI
10.13
mw
13.69 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.5|Prophage 3]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    653,432 → 653,812

    Biological materials

    Mutant

  • MGNA-C205 (ydiM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2203 NBRP B. subtilis, Japan]
  • BKE06040 (Δ[gene|F31946A3DF41D212ED552555C39C5FD6F6646C65|ydiM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTTCACCTCACATC, downstream forward: _UP4_TAACCAAATTTTTTACTCAA
  • BKK06040 (Δ[gene|F31946A3DF41D212ED552555C39C5FD6F6646C65|ydiM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06040 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAATTTTCACCTCACATC, downstream forward: _UP4_TAACCAAATTTTTTACTCAA