SubtiBank SubtiBank
yydB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yydB

unknown
locus
BSU_40220
pI
4.99
mw
56.29 kDa
protein length
481 aa Sequence Blast
gene length
1446 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,132,729 → 4,134,174

    The protein

    Protein family

  • [SW|Metallophosphoesterase superfamily] (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|660FD9F2AC911E4E70E242F14A2EA6A208F25E28|yyzF]-[gene|AC2A9DC3DA569231442582A95EDB2A98BA335184|yydA]-[gene|F30AA652362B7459D479345AB373D19FA1EAFBBF|yydB]-[gene|235399FB29FA7443D41AA9543EEB18F195503091|yydC]-[gene|1470E1E1BAE5EA5BA9831E2BCEF9B61E79450510|yydD]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B813 (yydB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1812 NBRP B. subtilis, Japan]
  • BKE40220 (Δ[gene|F30AA652362B7459D479345AB373D19FA1EAFBBF|yydB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAAACATCCTCTCAT, downstream forward: _UP4_AAGAATGATTGATCTTAAAA
  • BKK40220 (Δ[gene|F30AA652362B7459D479345AB373D19FA1EAFBBF|yydB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40220 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATACAAACATCCTCTCAT, downstream forward: _UP4_AAGAATGATTGATCTTAAAA