SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


similar to phage-related protein, skin-element
35.98 kDa
protein length
286 aa Sequence Blast
gene length
861 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    2,693,597 → 2,694,457

    Phenotypes of a mutant

  • overexpression of YqaM causes cell filamentation and abnormal chromosome segregation [Pubmed|20889742]
  • overexpression of YqaM inhibits initiation DNA replication, perhaps due to the interaction with [protein|5CF09E089AA70A32F640CE0D33D1F05312AAE24D|DnaC] [Pubmed|20889742]
  • The protein

    Paralogous protein(s)

  • [protein|8766A2EE18B75E50C5369AB8B72AD934F82D7545|XkdC]
  • Structure

  • [PDB|3ECC] (Aquifex aeolicus [protein|5CF09E089AA70A32F640CE0D33D1F05312AAE24D|DnaC], C-terminus of [protein|F301EA8201BF27BAFAD4F95EC3A580A91B970B06|YqaM], corresponds to aa 135 ... 277, 29% identity) [pubmed|19013274]
  • [SW|Localization]

  • Cytoplasm (Homogeneous) [Pubmed|16479537]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|20889742], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|846161AE54F170075F2B2133A8D56FE39A5AF8D9|SknR]: repression, [Pubmed|20889742], in [regulon|846161AE54F170075F2B2133A8D56FE39A5AF8D9|SknR regulon]
  • regulation

  • not expressed during normal growth ([protein|846161AE54F170075F2B2133A8D56FE39A5AF8D9|SknR]) [Pubmed|20889742]
  • additional information

  • A [protein|search|ncRNA] is predicted between [gene|CFCCFD8C6420CC1DD076B091AD3D914FC8AB22D5|yqaJ] and [gene|5EA0F507F949D249D5B5B860861BBEB4197E01C5|yqaI] [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE26260 (Δ[gene|F301EA8201BF27BAFAD4F95EC3A580A91B970B06|yqaM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCCTTACAATAAGGACAAT, downstream forward: _UP4_CAATTAAATCATAGGTTAGG
  • BKK26260 (Δ[gene|F301EA8201BF27BAFAD4F95EC3A580A91B970B06|yqaM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCCTTACAATAAGGACAAT, downstream forward: _UP4_CAATTAAATCATAGGTTAGG
  • References

  • 20889742,16479537,12060778,19013274