SubtiBank SubtiBank
ywbD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ywbD

similar to ribosomal RNA large subunit methyltransferase I
locus
BSU_38360
pI
9.18
mw
44.28 kDa
protein length
396 aa Sequence Blast
gene length
1191 bp Sequence Blast
function
unknown
product
putative ribosomal RNA large subunit methyltransferase
essential
no
synonyms
ipa-19d

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.3|rRNA modification and maturation/ based on similarity]
  • Gene

    Coordinates
    3,935,824 → 3,937,014

    The protein

    Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • [SW|Domains]

  • PUA domain (aa 1-79) (according to UniProt)
  • Structure

  • [PDB|3VSE] (from Staphylococcus aureus, 48% identity) [pubmed|23016631]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD|ywbD]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16430695], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B222 (ywbD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1221 NBRP B. subtilis, Japan]
  • BKE38360 (Δ[gene|F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD|ywbD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCGTCCTCTTTC, downstream forward: _UP4_TAAATGAAAAAGCTGCCCTG
  • BKK38360 (Δ[gene|F2F0B16E5F55C8C91C20E4FFC7A63E3CD09D4EFD|ywbD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATATGTCGTCCTCTTTC, downstream forward: _UP4_TAAATGAAAAAGCTGCCCTG
  • lacZ fusion

  • GP1614 ''amyE::p(ywbD-lacZ cat)'', constructed with pGP2150 based on [SW|pAC5], available in [SW| Jörg Stülke]'s lab
  • References

  • 16430695,18786544,23016631