SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


minor extracellular serine protease, involved in control of swarming motility
69.52 kDa
protein length
645 aa Sequence Blast
gene length
1938 bp Sequence Blast
protein degradation
minor extracellular serine protease

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Extracellular feeding proteases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW|Signal transduction in motility and chemotaxis] → [category|SW|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    3,939,869 → 3,941,806

    The protein

    Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Peptidase S8 domain] (aa 115-382) (according to UniProt)
  • Structure

  • [PDB|3WHI] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|subtilisin], corresponds to aa 27 ... 382, 40% identity) [pubmed|24279884]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|11751842], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16923912], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|16923912], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, not activated by [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P [Pubmed|19416356], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|16923912]
  • view in new tab

    Biological materials


  • 1A1021 ( ''epr''::''tet''), [Pubmed|20400548], available at [ BGSC]
  • KO7 (''ΔnprE ΔaprE Δepr Δmpr ΔnprB Δvpr Δbpr''), available as BGSC 1A1133
  • BKE38400 (Δ[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCTCCTTTTTC, downstream forward: _UP4_TAACCAAAAACCTTTAAGAT
  • BKK38400 (Δ[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCTCCTTTTTC, downstream forward: _UP4_TAACCAAAAACCTTTAAGAT
  • References


  • 20735481
  • Original publications

  • 16923912,3142851,19416356,18957862,19416356,11751842,23660663,24115457,24279884