SubtiBank SubtiBank
epr
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

epr

minor extracellular serine protease, involved in control of swarming motility
locus
BSU_38400
pI
9.88
mw
69.52 kDa
protein length
645 aa Sequence Blast
gene length
1938 bp Sequence Blast
function
protein degradation
product
minor extracellular serine protease
essential
no
synonyms
ipa-15r

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.3|Utilization of nitrogen sources other than amino acids] → [category|SW 2.3.3.5|Utilization of proteins]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW 3.3.7.2|Extracellular feeding proteases]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.1|Motility and chemotaxis] → [category|SW 4.1.1.1|Signal transduction in motility and chemotaxis] → [category|SW 4.1.1.1.5|Additional chemotaxis signal transduction and regulatory proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    3,939,869 → 3,941,806

    The protein

    Protein family

  • [SW|peptidase S8 family] (according to UniProt)
  • [SW|Domains]

  • [SW|Peptidase S8 domain] (aa 115-382) (according to UniProt)
  • Structure

  • [PDB|3WHI] ([protein|0B98DE9CE2D98FFDE9F6EEB4E94FA1E5204BD48D|subtilisin], corresponds to aa 27 ... 382, 40% identity) [pubmed|24279884]
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation

    Operons

    genes
    [gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]
    description
    [Pubmed|3142851]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|11751842], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, [Pubmed|16923912], in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC]: repression, [Pubmed|16923912], in [regulon|F7FD94CE7AB290FBFD3A9B88F204961668F9B42C|ScoC regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]: activation, not activated by [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU]-P [Pubmed|19416356], in [regulon|D343D2096664A972026D911E7A17A35C7B1CD1C9|DegU regulon]
  • regulation

  • repressed by [protein|search|SinR] [Pubmed|16923912]
  • view in new tab

    Biological materials

    Mutant

  • 1A1021 ( ''epr''::''tet''), [Pubmed|20400548], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1021&Search=1A1021 BGSC]
  • KO7 (''ΔnprE ΔaprE Δepr Δmpr ΔnprB Δvpr Δbpr''), available as BGSC 1A1133
  • BKE38400 (Δ[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE38400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCTCCTTTTTC, downstream forward: _UP4_TAACCAAAAACCTTTAAGAT
  • BKK38400 (Δ[gene|F2E3FF41357C672F80012CFE3076F890407B8B4A|epr]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK38400 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGATTCATCTCCTTTTTC, downstream forward: _UP4_TAACCAAAAACCTTTAAGAT
  • References

    Reviews

  • 20735481
  • Original publications

  • 16923912,3142851,19416356,18957862,19416356,11751842,23660663,24115457,24279884