SubtiBank SubtiBank
yflG
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yflG

methionine aminopeptidase
locus
BSU07690
pI
5.58
mw
27.06 kDa
protein length
249 aa Sequence Blast
gene length
750 bp Sequence Blast
function
removal of N-terminal methionine from nascent proteins
product
methionine aminopeptidase
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.1|Translation] → [category|SW 3.3.1.12|Translation/ other]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.1|Protein maturation]
  • Gene

    Coordinates
    839,735 → 840,484

    The protein

    Catalyzed reaction/ biological activity

  • Release of N-terminal amino acids, preferentially methionine, from peptides and arylamides (according to Swiss-Prot)
  • Protein family

  • peptidase M24A family (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|2F2455E189FC61A6B1EC6B66412FC662E44BD3F6|Map]
  • Structure

  • [PDB|1QXW] (from Staphylococcus aureus, 51% identity) [pubmed|14998322]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]-[gene|FB3A0E7A2428AA374C844C26464FAF8D40ADF142|yflH]-[gene|2BD3B1B122C902C01C88C97F0D5CD20962C9676B|yflI]
    description
    [Pubmed|22383849,16207374]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|16207374], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|15805528], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • regulatory mechanism

  • [protein|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR]: repression, (weak and not certain) [Pubmed|16207374], in [regulon|6D36D6360FE1CBFF5F64B2A6D1406405D6C6F7D5|NagR regulon]
  • regulation

  • induced by stress ([protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]) [Pubmed|15805528]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C255 (yflG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2253 NBRP B. subtilis, Japan]
  • BKE07690 (Δ[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE07690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATTCCCGCTTTC, downstream forward: _UP4_TAAAACACATTCCGGGCTTC
  • BKK07690 (Δ[gene|F2DE9BFE16D7B0DAE92DB58F9B1EDFBB7557ED16|yflG]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK07690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTGTCATTCCCGCTTTC, downstream forward: _UP4_TAAAACACATTCCGGGCTTC
  • References

  • 16207374,14998322