SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


endonuclease V
26.83 kDa
protein length
238 aa Sequence Blast
gene length
717 bp Sequence Blast
DNA repair
endonuclease V

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW|Other proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    3,724,420 → 3,725,136

    Phenotypes of a mutant

  • increased mutation rates [Pubmed|22056936]
  • increased sensitivity of sporulating cells to the genotoxic effects of nitrous acid[Pubmed|27698084]
  • increased mutation rates [pubmed|30726292]
  • The protein

    Catalyzed reaction/ biological activity

  • Endonucleolytic cleavage at apurinic or apyrimidinic sites to products with a 5'-phosphate (according to UniProt)
  • in vitro endonuclease activity against double-stranded DNAs containing a single uracil (U), hypoxanthine (Hx), xanthine (X) or an AP site [pubmed|30726292]
  • catalyzes a single strand break at the second phosphodiester bond towards the 3'-end of the U and AP lesions [pubmed|30726292]
  • Protein family

  • endonuclease V family (single member, according to UniProt)
  • Structure

  • [PDB|3GA2]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation




  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab



  • expressed throughout growth and staionary phase [Pubmed|22056936]
  • view in new tab

    Biological materials


  • MGNA-A566 (ywqL::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE36170 (Δ[gene|F2C6956D69FBE57933E46136436E8E80B63DF8BB|ywqL]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAATACCTTCATAACGA, downstream forward: _UP4_TAACACTTGGGGCTCTAAGT
  • BKK36170 (Δ[gene|F2C6956D69FBE57933E46136436E8E80B63DF8BB|ywqL]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAAATACCTTCATAACGA, downstream forward: _UP4_TAACACTTGGGGCTCTAAGT
  • References

  • 9353933,22056936,22383849,27530626,27698084,30726292