SubtiBank SubtiBank
yqfU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqfU

unknown
locus
BSU_25110
pI
6.26
mw
32.31 kDa
protein length
293 aa Sequence Blast
gene length
882 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    2,592,003 → 2,592,884

    The protein

    Protein family

  • [SW|UPF0750 membrane proteins] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]-[gene|A0CD8CCB54AE9F10DE3C876FB47B9877C303862D|zur]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C421 (yqfU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2419 NBRP B. subtilis, Japan]
  • BKE25110 (Δ[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCTCCTTTCCTGC, downstream forward: _UP4_TAGGCTTTCATTTACTTTTA
  • BKK25110 (Δ[gene|F2B25938E665BD4FB06DD3A09EDA0FA1AB101B24|yqfU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25110 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAATCTCCTTTCCTGC, downstream forward: _UP4_TAGGCTTTCATTTACTTTTA
  • References

  • 12486072