SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


menaquinol:cytochrome c oxidoreductase (cytochrome b/c subunit), component of the cytochrome bc complex
28.01 kDa
protein length
255 aa Sequence Blast
gene length
768 bp Sequence Blast
menaquinol:cytochrome c oxidoreductase (cytochrome b/c subunit)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Respiration/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,363,111 → 2,363,878

    The protein

    Protein family

  • cytochrome b family (with [protein|1DC5C6DAF0AB1EB59BC9361DC1161E75F99AFE33|QcrB], according to UniProt)
  • [SW|Domains]

  • Cytochrome c domain (aa 178-255) (according to UniProt)
  • [SW|Localization]

  • cell membrane [Pubmed|23880299]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7592464], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|8631715], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • induced by oxygen limitation ([protein|search|ResD]) [Pubmed|8631715]
  • view in new tab

    Biological materials


  • BKE22540 (Δ[gene|F2973C512AFB4B9F8FE0CCAF09646E60F886C013|qcrC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCCCTCCCTTTT, downstream forward: _UP4_TAACGTATTGTGAATTGTCA
  • BKK22540 (Δ[gene|F2973C512AFB4B9F8FE0CCAF09646E60F886C013|qcrC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTCATCCCCTCCCTTTT, downstream forward: _UP4_TAACGTATTGTGAATTGTCA
  • References

  • 8631715,7592464,12850135,12107147,23599347,20817675,23880299,27503613