SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


legionaminic acid synthesis
40.73 kDa
protein length
373 aa Sequence Blast
gene length
1122 bp Sequence Blast
legionaminic acid synthesis

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.6|Miscellaneous metabolic pathways] → [category|SW|Biosynthesis of legionaminic acid (for spore crust))]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    3,887,741 → 3,888,862

    Phenotypes of a mutant

  • less hydrophobic spore surface [pubmed|32817102]
  • The protein

    Catalyzed reaction/ biological activity

  • required for spore crust assembly, legionaminic acid synthesis [pubmed|32817102]
  • [SW|Domains]

  • AFP-like domain (aa 305-367) (according to UniProt)
  • Structure

  • [PDB|1VLI]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [ PubMed]
  • view in new tab

    Biological materials


  • BKE37870 (Δ[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCGCGATCTGAAACGCTG, downstream forward: _UP4_ATTTTACTGAAGGACAGCCC
  • BKK37870 (Δ[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTCGCGATCTGAAACGCTG, downstream forward: _UP4_ATTTTACTGAAGGACAGCCC
  • References

  • 9353933,15383836,26577401,32817102